Видео Дня
Только сегодня!
800 530p.
Нужно ли делать телефон для справок/помощи на сайте?
 

И опять случилось чудо

Здравствуйте!
Уже далеко девяностые годы, а кажется, совсем это было недавно. Я жила с двумя детьми. С мужем развелись, я переехала поближе к родителям. Состояние моё было ужасное. Операция за операцией, ушиб головного мозга. Из пульмоотделения года три не выползала, а мне всего-то было около 40 лет.
Дальше постперестроечные годы – ни работы, ни зарплаты. Выживали с соседкой и детьми (у неё тоже двое), как могли. Всю зиму лепили вареники из подмерзшей картошки и делали лепёшки. подробнее...

Подписка

Будьте с нами!

Напишите свой e-mail и 2 раза в месяц мы будем оповещать вас о новинках, предстоящих событиях и об интересных статьях и письмах наших читателей.



Рейтинг@Mail.ru

Сыновья Адама и дочери Евы

 

adam son

 

Сыновья Адама

С помощью меток, оставленных случайными мутациями на Y-хромосоме, вы можете проследить свою родословную по мужской линии вплоть до Адама. Правда, не библейского.

Вопрос «откуда есть пошла?..» для целых племен и народов до недавнего времени решался с помощью данных истории, археологии, лингвистики и других не очень точных наук. Определить свою личную родословную любой человек мог с помощью архивов ЗАГСов, ревизских сказок, церковноприходских книг — на три, пять, хорошо если на 10–15 поколений.

Сейчас любой из нас может определить свою родословную до прародителей человечества. Правда, не библейских, а молекулярно-генетических — «митохондриальной Евы» и «Y-хромосомного Адама». К ним, жившим в Юго-Восточной Африке (по самым общепринятым из условных и приблизительных оценок — 150–170 или 60–80 тысяч лет назад), сходятся ветви генеалогического древа каждого из живущих на Земле 6,6 млрд человек. За прошедшие века в нашей ДНК, как визы в паспорте, добавились пометки о путях, по которым потомки Адама разбрелись по миру.

adam son 2 1

Какой народ каким путем добрался до нынешнего места жительства за тысячелетия великих и незаметных переселений, завоеваний, объединений и смешений? Как носило по свету лично ваших предков с тех пор, как они покинули колыбель народов — Африку? И от какой из групп этих переселенцев вы происходите — отдельно по отцовской и материнской линии? Сколько поколений назад жил ближайший предок, от которого по прямой линии произошли лично вы и кто-нибудь из ныне царствующих особ? На все эти вопросы может ответить анализ ДНК.

 

Генографический проект

adam son 3

Изучать этногеномику начали в 1980-х годах, когда компьютеры еще не обладали таким быстродействием, а методы анализа ДНК были на несколько порядков медленнее и дороже нынешних. Сейчас самый простой, но достаточно полный анализ индивидуальной молекулярной генеалогии, по 12 маркерам Y-хромосомы, стоит $100–150, а более чем достаточный, по 37 маркерам Y-ДНК + полный тест митохондриальной ДНК, — около $400. Базы данных на десятки тысяч образцов ДНК есть у ряда коммерческих фирм и общественных институтов, и большинство из них (с определенными ограничениями на допуск к персональной информации) открыты для всех. За счет интереса людей к своим индивидуальным родословным информация в этих базах накапливается быстрее, чем ученые успевают ее обработать. Самое грандиозное из исследований целых популяций — Genographic Project («Генографический проект»), начатый в 2005 году Национальным географическим обществом США (National Geographic Society) при поддержке компании IBM. Цель проекта — за пять лет собрать не менее 100 000 образцов ДНК типичных представителей народов или племен, история которых известна по данным этнографии, истории и археологии, чтобы уточнить пути миграций человечества по Земле. На самом деле и такая огромная выборка — капля в море по сравнению с реальным разнообразием рас и племен, но по мере добавления информации результаты можно будет уточнять. Даже черновой план, составленный участниками проекта под руководством доктора Спенсера Уэллса, — захватывающее зрелище, особенно в виде интерактивной карты на сайте проекта. Но для начала разберемся с терминами.

 

Молекулярная генеалогия

При образовании половых клеток из диплоидных клеток-предшественников их соматические хромосомы (а у женщин — и половые) обмениваются участками — примерно так, как происходит, если не слишком тщательно перетасовать две колоды карт с рубашками разного цвета и снова разложить их на два одинаковых набора независимо от цвета рубашек. По четверти генома мы получаем от каждого из двух дедушек и двух бабушек, 1/8 — от прадедов и прабабок... В наших хромосомах есть гены не только Адама и Евы, но и всех их близких и дальних родственников, живших 70–80 тысяч лет назад, когда численность нашего вида снизилась до критической величины — примерно 10 000 особей, и более далеких предков, вплоть до первых млекопитающих и даже первых многоклеточных животных. Но от них мы получили только соматические и X-хромосомы, гены которых в результате постоянного перемешивания расплываются по всей популяции. Почти неизменными из поколения в поколение переходят только Y-хромосома и митохондриальная ДНК. На этом «почти» и основана вся молекулярная генеалогия, изучающая историю по мутациям, произошедшим у предков и сохранившимся в ДНК потомков.

 

Мутации: полезные, вредные и нейтральные

Обычно крупные мутации — например, перемещение на другое место, удвоение или, наоборот, выпадение крупного участка хромосомы, несущего один или несколько генов, — не приводят ни к чему хорошему. Как, впрочем, и часто встречающиеся одиночные нуклеотидные полиморфизмы — SNP, если они происходят в пределах одного из 21 000 человеческих генов.

adam son 4

Полезные мутации происходят намного реже и сохраняются в последующих поколениях. Вредные — удаляются из популяции вместе с носителем или еще на стадии эмбриона, или, при тяжелой наследственной болезни, до того, как этот носитель успеет обзавестись потомством. В результате действия стабилизирующего отбора и происходивших время от времени снижений численности вида, уменьшающих его генетическое разнообразие, строение генов у двух выбранных наугад людей совпадает на 99,9%. Все наши отличия, от цвета кожи и разреза глаз до роста и склонности к определенным болезням, определяют в основном генные полиморфизмы — незначительные различия в нуклеотидных последовательностях практически одинаковых генов и, соответственно, в строении и функциях закодированных в этих генах белков.

Во-первых, случайные мутации происходят постоянно, и полиморфизмами считают те из них, которые произошли давно и поэтому встречаются чаще, чем у 1% людей в данной популяции (граница здесь условная — можно было бы считать случайными и варианты генов, встречающиеся реже, чем у 2–3%). Во-вторых, полиморфизмы не оказывают заметного влияния на здоровье их носителей или даже носят приспособительный характер. Правда, и здесь граница довольно размытая. Классический пример — SNP, обусловливающий у гомозигот — носителей двух мутантных генов — тяжелое наследственное заболевание, серповидноклеточную анемию. Но гетерозиготы по этому гену — носители здорового варианта на одной хромосоме и «испорченного» на другой — реже болеют малярией, а симптомы анемии испытывают только в экстремальных условиях, например в высокогорье. Эта мутация встречается на юге Индии, в Средиземноморье и у жителей Западной Африки и их потомков на других континентах.

При копировании хромосом «снипы» происходят с вероятностью 10–8 на один нуклеотид за поколение. При размере гаплоидного генома в 3 млрд (3 × 109) нуклеотидов за счет случайных точечных мутаций каждый ребенок имеет в среднем около 30 однонуклеотидных различий со своими родителями. По счастью, большинство таких мутаций приходится не на гены, а на так называемую мусорную ДНК — примерно 95% человеческого генома, не кодирующих ни белков, ни служебных РНК. Эти мутации ни на что не влияют, отбору они безразличны — вот они и сохраняются среди остального генетического «хлама». Именно их, а также короткие тандемные повторы и используют в молекулярной генеалогии в качестве хромосомных маркеров — характерных особенностей.

 

Мальчики и девочки

Начнем с Адама: с мужской молекулярной генеалогией разобраться проще (впрочем, всё сказанное ниже о своем происхождении по мужской линии могут узнать и дамы — для этого нужно проанализировать ДНК отца, или брата, или дяди — любого прямого родственника по отцу).

adam son 5

Примерно 300 млн лет назад у первых млекопитающих одна из хромосом, несущая среди прочих несколько генов, определяющих принадлежность к мужскому полу, начала терять остальные гены и вместе с ними — способность обмениваться участками ДНК с парной хромосомой. У человека на Y-хромосоме осталось всего 27 генов, большинство из них работают в семенниках. Остальная часть Y-хромосомной ДНК может пригодиться разве что для этнографии и генеалогии. Мутации — выпадения, замены или добавления одиночных нуклеотидов (SNP) и изменения числа повторений трех-четырех одинаковых нуклеотидов (STR) — происходят в разных участках Y-хромосомы с разной частотой, в среднем — одна мутация на каждые 500 поколений. В самых консервативных участках мутации случаются раз в 100 000 лет.

Y-хромосомный Адам жил примерно 80 000 лет назад, но «раз в 100 000 лет» — это вероятность мутации в этом участке хромосомы в непрерывном ряду поколений, и можно подсчитать, что даже такой редкий случай может произойти один раз в поколение примерно у одной из 3000 пар «отец–сын». Время и место жизни нашего общего прямого предка вычислили по анализу распределения в популяциях из разных регионов планеты Y-хромосомных маркеров. Их используют и для исследований в области этногеномики, и для выяснения индивидуальных генеалогий.

 

История и география

У населения старинных русских городов чаще всего встречаются гаплогруппы R1a, I1b и N. Очень условно их носителей можно назвать соответственно потомками восточных, южных и северных славян. На самом деле мутация, определяющая принадлежность к ветви R, предположительно появилась на северо-западе Азии 30–35 тысяч лет назад: в племени, все мужчины которого (или большинство из них) относились к более ранней гаплогруппе P, родился мальчик, в Y-хромосоме которого произошел сбой — замена всего одного нуклеотида, аденина на гуанин. Его потомки расселились по Европе и западной части Азии, по дороге смешиваясь с местными племенами, но у всех его прямых наследников сохранилась эта метка — маркер M207. Ее нашли и у мужчин одного из изолированных племен Камеруна — скорее всего, это потомки части доисторического племени, которая вернулась из Евразии в Африку.

 

Славянский базар

Подгруппа R1a (M17) зародилась в степях на территории нынешней Украины и юга России 10–15 тысяч лет назад. Племена известной по археологическим данным курганной культуры одними из первых приручили лошадь и за счет этого расселились чуть ли не по всему континенту, покорили туземцев, перемешались с ними и навязали им свой язык и религию, ставшие основой протоиндоевропейской (индоарийской) культуры. К прямым потомкам индоариев относятся 45% мужчин в высших кастах Индии, 40% поляков, северных русских, украинцев, белорусов, латышей и литовцев. Немного реже — южные и западные славяне, исландцы (Рюрик тоже был викингом), восточные немцы и народы России, язык которых относится к финно-угорской группе (тысячелетия соседства давно перемешали «русь, мордву и чудь»). Несмотря на все смешения племен, носители подгруппы R1a в южнорусских городах составляют 55% мужского населения, а в центральной России — до 70%. Но если кто-нибудь решит на основании принадлежности к этой подгруппе гордиться своей арийской кровью, напоминаем: ваши родственники живут и в пустыне Калахари, и далее по глобусу до Гренландии, Австралии и Огненной Земли. Кстати, среди казахов — во всем остальном типичных монголоидов — носителей подгруппы R1a не меньше, чем в России. Да, скифы мы...

У кого-то из пра-пра...правнуков родоначальника гаплогруппы R, двигавшихся понемногу на юг, 25 000 лет назад произошла еще одна мутация, M127. Ее носители, представители гаплогруппы R2, составляют 5–10% населения юга Центральной Азии, Пакистана и северной Индии. Еще одна ветвь этой группы повернула на запад, на земли, с которых сползал последний ледник. Подгруппа R1, у которой к предыдущим меткам на Y-хромосоме приблизительно 30 000 лет назад добавилась мутация M173, — самая распространенная в Европе и западной Евразии.

Этногеномика имеет дело с вероятностями мутаций, полученными путем приблизительных подсчетов, выборками из популяций и другими среднестатистическими величинами. Даже число тысячелетий в расчетах зависит от того, какое время смены поколений, от 20 до 35 лет, выберут авторы работы. Максимальное приближение во времени, которое показывает гаплогруппа даже с самым длинным буквенно-цифровым индексом, — это вероятность появления одного SNP, в лучшем случае 5000 лет, так что деталей индивидуальной генеалогии по ней не определить. Можно разве что спорить, родственниками в двухсотом или трехсотом колене приходятся друг другу больше трети жителей северной Индии, почти половина русских и почти треть норвежцев.

 

Генеалогия

А можно ли построить генеалогическое древо человека с более высокой точностью? Можно, но SNP для этого не подходят. Для детальных исследований в молекулярной генеалогии применяют короткие тандемные повторы — STR. При образовании сперматозоидов ферменты, копирующие ДНК клетки-предшественника, иногда пропускают или добавляют к такому тандему один из повторов. Если этот сперматозоид примет участие в рождении мальчика, все его сыновья, внуки и правнуки сохранят новую запись в этом маркере до тех пор, пока прямой род по мужской линии не оборвется — или до следующей мутации в том же STR. Повторная мутация может увеличить разницу в большую или меньшую сторону, сделав различия между ветвями древа более четкими, а может и восстановить исходное состояние. Но при использовании большого числа маркеров степень родства можно установить достаточно точно.

 

Ключи от генеалогического древа

ДНК представляет собой последовательность нуклеотидов, которые обозначаются буквами G (гуанин), T (тимин), A (аденин) и C (цитозин). Например, фрагмент ДНК может быть вот таким:

...GTACAAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG...

Или вот таким:

...GTACAAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG

Обратите внимание на повторяющуюся комбинацию. Этоиесть STR (short tandem repeat). Время от времени в «мусорной» части ДНК встречаются вот такие бессмысленные повторения трех-четырех нуклеотидов, в данном случае TAGA (тимин-аденин-гуанин-аденин). Это первый из наиболее часто используемых маркеров Y-хромосомы, DYS19 (DNA Y-chromosome Segment № 19), и приведенные для примера сочетания обозначаются как DYS19=14 и DYS19=15.

Теперь давайте посмотрим на другую последовательность:

...GTACTAGAG(TAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGA)CTGGTG...

adam son 6Это очень похоже на первую последовательность, но в пятом нуклеотиде произошла замена аденина на тимин. Это и есть SNP — одиночный нуклеотидный полиморфизм (single nucleotide polymorphism, «снип») Y-хромосомы. Ключевые «снипы» однозначно определяют гаплогруппу человека, то есть «ветвь» на дереве миграций человечества. Набор STR-маркеров Y-хромосомы определяет гаплотип человека. При сравнении гаплотипов двух человек можно (при совпадении гаплогруппы) приблизительно определить количество поколений до ближайшего общего предка по мужской линии.

У всех мужчин на Земле в локусах DYS19, 388, 390, 391, 392 и 393 есть тандемные повторы разной длины. Например, квадруплет TAGA (DYS19) может повторяться от 10 до 19 раз, триплет АТА (DYS388) — 10–16 раз и т. д. У 98% мужчин к базовому набору из шести общих маркеров, унаследованных от хромосомного Адама, добавился DYS385 — от 7 до 28 повторов «GAAA». У 34% есть еще DYS438 и 439 и т. д. В качестве генеалогических маркеров выбраны самые информативные из почти пятисот обнаруженных на Y-хромосоме STR. Стандартные ДНК-генеалогические тесты проводят по 12, 25, 37 или 67 маркерам, хотя уже шести часто достаточно для того, чтобы по комбинации числа повторов отнести «владельца» этого гаплотипа (индивидуального набора маркеров) к одной из гаплогрупп, от A до R. Например, так называемый «атлантический модальный гаплотип», наиболее распространенный на западе Европы, выглядит так: DYS19=14, DYS388=12, DYS390=24, DYS39=11, DYS392=13, DYS393=13. Человек с таким гаплотипом практически со стопроцентной вероятностью относится к гаплогруппе R1b или ее подвариантам.

Чем меньше расхождений в числе повторов нуклеотидных групп во всех проанализированных DYSах между двумя гаплотипами, тем больше вероятность того, что их носители — родственники. В тесте по 37 маркерам вероятность случайного совпадения всех из них — 1/637, 1 шанс из 6 × 1028 (население Земли, напомним, 6,6 × 109 ). Даже по 12 маркерам вероятность случайного совпадения — 1 шанс из двух с лишним миллиардов, и при полном совпадении чьих-нибудь DYS с вашим гаплотипом (и совпадении гаплогруппы) можно быть уверенным, что вы нашли брата, отца, дядю или «многоюродного» (но не более чем в десятом-пятнадцатом колене) родственника по прямой мужской линии. А что может быть в случае, если в такой базе вы найдете последовательность чисел, отличающуюся от вашей на 1, 2 или 5 единиц? Можно прикинуть, сколько поколений назад жил ваш ближайший общий предок. Расхождение на один повтор в любом из маркеров происходит в среднем один раз в 500 поколений, примерно раз в 15 000 лет. В гаплотипе из 37 маркеров одна мутация может произойти примерно раз в 13 поколений, или в 300–400 лет. Хотя средние частоты мутаций в различных DYS отличаются, они известны, так что можно еще немного уточнить возможное время расхождения. Правда, всё равно это будет всего лишь вероятность, но дальше уже можно будет покопаться в бумажных данных, от семейных архивов до летописей. И в любом случае вы узнаете много интересного, особенно если к информации об Y-хромосоме добавить анализ митохондриальной ДНК. Но о родстве по материнской линии читайте далее.

 

Дочери Евы

По меткам, оставленным случайными мутациями на митохондриальной ДНК, и мужчины и женщины могут проследить свою родословную по женской линии вплоть до самой «праматери» — Евы.

Прежде всего стоит заметить, что «Y-хромосомный Адам» и «митохондриальная Ева» — не супружеская пара, от которых произошло современное человечество. Они даже не были первыми людьми современного типа, «Адам» жил на десятки тысяч лет позже «Евы». Почему же именно от них мы ведем свою родословную? Примерно по той же причине, по которой генеалогические древа дворянских родов начинаются с самых дальних предков, которых можно разглядеть во тьме веков. «Адам» и «Ева» — не реальные люди, а виртуальные точки, с которых начинается ветвление молекулярно-генеалогического древа человечества.

 

Почему Адам настолько моложе Евы?

Обрывы в наследовании по мужской линии случаются намного чаще, чем по женской. На самцах природа чаще экспериментирует: если мутация в кодирующей части генома окажется полезной, самец передаст ее потомкам обоих полов, окажется вредной — для выживания вида и без него самцов хватит. Самки вьют гнездышки, поддерживают огонь в очаге и ковыряются в огороде. Самцы охотятся на мамонтов и лупят друг друга по головам дубинами, а те, кто сильнее, заводят себе гаремы и отгоняют от них хищников и других самцов. Поэтому непрерывные женские линии нашей родословной можно проследить намного дальше, и разных гаплогрупп по мтДНК сохранилось больше, чем мужских.

 

Предыстория

В молекулярной генеалогии, как и в обычной, происхождение целых народов и отдельных людей прослеживается отдельно по отцовской и материнской линиям.

Если мужчина — носитель Y-хромосомы — не оставит потомков мужского пола, ветвь генеалогического древа по мужской линии обрывается. Наследование по женской линии, через митохондриальную ДНК (мтДНК), обрывается на каждом мальчике: полученные от матери митохондрии, дающие энергию для вращения хвостика сперматозоида, если и попадают в яйцеклетку, то по каким-то причинам разрушаются. И мужчины и женщины получают митохондрии из цитоплазмы материнской яйцеклетки, женщины передают ее своим дочерям, те — своим... Женская линия полностью обрывается в случае, если у женщины не будет дочерей. Так что даже при стабильной численности популяции, когда в среднем у каждой пары двое детей доживают до репродуктивного возраста, из-за случайных комбинаций пола потомков (два мальчика, две девочки или мальчик и девочка) в каждом поколении прервется четверть прямых линий половых маркеров, в следующем — еще четверть... Теоретически через несколько десятков поколений число прародительских мтДНК и Y-хромосом уменьшится до исчезающее малой величины. Практически в популяции сохраняются маркеры тех родов, в которых такие обрывы не произошли — по чистой случайности или из-за редких положительных мутаций. Генетическое разнообразие дополнительно уменьшается, когда после засухи, наводнения, голодной зимы и т. д. от целого племени остается только горстка выживших. Увеличиваться разнообразие наследственных маркеров и генома популяции в целом может и за счет принятых в племя чужаков, и за счет случайных мутаций, особенно тогда, когда популяция растет, — но потом снова случаются голод, война, извержение вулкана или наступление ледника. Наверняка у Адама были братья и дяди по отцовской линии, а у Евы — сестры и тетки, но рассмотреть их следы по половым маркерам невозможно.

eva daughter 2

Африканское происхождение Евы вычислили еще в 1980-х годах. Адама — на 10 лет позже: число нуклеотидных пар в Y-хромосоме в тысячи раз больше, чем в мтДНК, и анализировать их последовательности намного сложнее. В обоих случаях по распределению мутаций-маркеров в пробах ДНК представителей племен, которые, по этнографическим данным, являются прямыми потомками первых поселенцев на данной территории, общие для всех современных народов маркеры нашли только в Африке. Оставшиеся на прародине человечества племена за тысячи лет приобрели свои маркеры, а наследники тех, кто разными путями расселился по свету, — свои. По частоте встречаемости этих меток в разных регионах планеты можно восстановить пути древних миграций и по Африке, и по всему миру. А знание вероятности появления случайных мутаций позволило рассчитать время жизни наших общих прямых предков по женской и мужской линиям — 150–200 тысяч и 60–80 тысяч лет назад соответственно — очень приблизительно и с огромными доверительными интервалами.

 

От сотворения мира

Миллиарды лет назад митохондрии были бактериями, которые поселились в клетках примитивных эукариотических (имеющих клеточное ядро с линейными хромосомами) организмов и взяли на себя работу по производству тепла и энергии для хозяина. За время совместной жизни часть своих генов они растеряли за ненадобностью при жизни на всем готовом, часть — передали в ядерные хромосомы, и сейчас двойное кольцо мтДНК человека состоит всего из 16 569 пар нуклеотидных оснований. Большую часть митохондриального генома занимают 37 генов. Из-за высокой концентрации свободных радикалов кислорода (побочных продуктов окисления глюкозы) и слабости механизма восстановления ошибок при копировании ДНК мутации в мтДНК происходят на порядок чаще, чем в ядерных хромосомах. Замена, выпадение или добавка одного нуклеотида здесь происходят примерно один раз в 100 поколений — около 2500 лет. Мутации в митохондриальных генах — нарушения в работе клеточных энергостанций — очень часто бывают причиной наследственных болезней.

 

Клеточная энергостанция

Единственная функция митохондрий — окисление глюкозы до углекислого газа и воды и синтез за счет выделяющейся при этом энергии клеточного топлива — АТФ и универсального восстанавливающего агента (переносчика протонов) НАДН. (НАДН — это никотинамидадениндинуклеотид — попробуйте произнести без запинки.) Даже для этой простой задачи нужны десятки ферментов, но большинство генов белков, необходимых для работы и текущего ремонта митохондрий, давно перешли в хромосомы клеток «хозяев». В мтДНК остались только гены транспортных РНК, поставляющих аминокислоты к синтезирующим белки рибосомам (обозначены однобуквенными латинскими символами соответствующих аминокислот), два гена рибосомальных РНК — 12s RNA и 16s RNA (гены белков митохондриальных рибосом находятся в ядре клетки) и некоторые (не все) гены белков основных митохондриальных ферментов — НАДH-дегидрогеназного комплекса (ND1-ND6, ND4L), цитохром-c-оксидазы (COI-III), цитохрома b (CYTb) и двух белковых субъединиц фермента АТФ-синтетазы (ATPase8 и 6). Для нужд молекулярной генеалогии используется некодирующий участок — D-петля, состоящая из двух гипервариабельных регионов, низкого и высокого разрешения — HVR1 и HVR2.

Тандемных повторов, которые используют в мужской ДНК-генеалогии, в мтДНК нет, и бессмысленных последовательностей очень мало: гены расположены вплотную друг к другу, разделяясь вставками из нескольких нуклеотидов. Для молекулярно-генетических исследований пригодна главным образом так называемая петля смещения — некодирующий участок размером 1143 пары нуклеотидов. Зато и мутации в нем происходят (вернее, сохраняются, так как практически не влияют на работу митохондрий) еще чаще, около одного раза в 1000 лет. Этот гипервариабельный участок мтДНК делят на два отрезка, лежащих по сторонам от нулевой точки, с которой начинается расхождение двойной спирали мтДНК при ее копировании. На отрезке от 16 001-го до 16 569-го нуклеотида находится «область низкого разрешения», HVR1 (hypervariable region 1), по которой можно определить гаплогруппу и, если повезет, получить немного дополнительной информации. Отклонения от стандарта в области высокого разрешения (HVR2), в 1–575-х нуклеотидах, используют для детального анализа. Правда, для индивидуальной родословной проследить родство по материнской линии удается не так точно, как по отцовской.

 

Женская логика

Путаница с классификацией в молекулярной генеалогии по женской линии началась еще в 1981 году, когда ученые Кембриджского университета опубликовали полученные под руководством нобелевского лауреата Фредерика Сэнджера результаты первого секвенирования — анализа последовательности нуклеотидов — человеческой мтДНК. Этот текст из 16 569 нуклеотидов, Кембриджскую стандартную последовательность (Cambridge Reference Sequence, CRS), и приняли за эталон. Отклонения от него называют мутациями и обозначают комбинацией числа (номера нуклеотида) и буквы (названия нуклеотида). Например, 1651С означает, что нуклеотид под номером 1651 (в «стандартной» CRS это тимин, Т) заменен на цитозин (C), а 315.1С говорит о том, что после 315-го нуклеотида в «стандартную» цепь вставлен один лишний цитозин.

CRS относится к одной из самых молодых гаплогрупп мтДНК. Она — результат сотен мутаций исходной последовательности, ведущей начало от «Евы». Но менять устоявшуюся классификацию слишком сложно, проще приспособиться к сложившейся номенклатуре.

eva daughter 3

Гаплогруппы мтДНК, как и Y-хромосомные, обозначают латинскими буквами (это иногда приводит к путанице среди любителей, когда один из спорщиков пишет о материнской, а другой — об отцовской группе). Мужские гаплогруппы от A до R проиндексированы в порядке появления на генеалогическом древе соответствующих точечных мутаций. Самые древние женские относятся к надгруппе L, от L0 до L3, а относительно поздние, встречающиеся у индейцев Южной Америки и их азиатских родственников, получили индексы от A до D. К тому же, несмотря на то что на Y-хромосоме места для мутаций намного больше, женские гаплогруппы намного разнообразнее, и для вновь выявленных промежуточных групп приходится вводить комбинированные индексы вроде CZ и pre-JT.

 

Тысячи лет и километров

Автор книги «Семь дочерей Евы» Брайан Сайкс придумал для предполагаемых прародительниц большей части населения Европы имена — Урсула (гаплогруппа U), Ксения (X), Елена (H), Велда (V), Тара (T), Катрин (K) и Жасмин (J). Можно проследить и нанести на карту магистральные дороги, по которым они и остальные наши прапрабабки кочевали во времени и пространстве, и рассчитать предполагаемое время для каждой развилки — появления новой мутации, от первых «дочерей Евы» до самых недавних — гаплогрупп I и V, которым всего около 15 000 лет.

 

Потомки выживших

Потомки «Елены», носители митохондриальной гаплогруппы H, включающей уже более 30 подгрупп, составляют подавляющее большинство — около 40% — современного населения Европы. Может быть, замена всего одного нуклеотида в некодирующем (а на самом деле — принимающем участие в регуляции работы митохондриальных генов) отрезке — это одно из последних эволюционных изменений в человеческом геноме, которое и привело к росту популяции носителей этой гаплогруппы. В 2005 году исследователи из Университета Ньюкасла под руководством профессора Патрика Чиннери обнаружили, что среди пациентов, перенесших тяжелую бактериальную инфекцию, выживаемость носителей гаплогруппы H была в два раза выше, чем у представителей девяти других гаплогрупп. Возможно, именно это обусловило ее распространение в Европе.

eva daughter 6 500

Но, глядя на такую карту, надо учесть, что группы мтДНК расплываются по Земле намного шире, чем Y-хромосомные. Казалось бы, путешествия — мужское дело, но из них мужчины возвращались с выручкой или добычей (а также с невестами или пленницами). Многие, конечно, оставались на завоеванных землях, но даже походы Аттилы и Чингисхана — пустяки по сравнению с тем, что у большинства народов жена переезжала в дом мужа, а ее дочери тоже выходили замуж в соседнюю деревню. В результате разнообразие женских гаплогрупп в современных популяциях в несколько раз больше, чем мужских.

eva daughter 4

В массовых исследованиях вроде проекта «Генография» в мтДНК анализируют только зону низкого разрешения, HVR1, по которой можно определить принадлежность к одной из двух дюжин гаплогрупп по материнской линии. При этом чем более распространенной является ваша группа, тем больше дальних родственников вы найдете в базе данных. Но все пробы ДНК — и полученные в ходе плановых работ у «типичных туземцев», и присланные индивидуальными участниками, хранятся годами и десятилетиями, так что за отдельную плату желающие уточнить детали своей молекулярной генеалогии могут заказать дополнительные анализы, сужая число совпадающих гаплотипов. Правда, даже полное совпадение у двух человек всех маркеров в обеих областях петли, HVR1 и HVR2, говорит только о том, что с вероятностью 50% их общая прапра...бабушка по материнской линии жила около 700 лет назад. Можно секвенировать полную последовательность мтДНК и несколько соматических маркеров, но это вряд ли даст дополнительную информацию об индивидуальной генеалогии — разве что в особых случаях. Один из бесконечных бразильских сериалов крутится вокруг бесконечных анализов ДНК, а в жизни всё намного проще — и намного сложнее.

 

Наше всё

eva daughter 5В одном из недавних генографических исследований выяснилось, что типично африканские маркеры встречаются в хромосомах у 30% американцев, искренне считающих себя белыми — привет им от великого эфиопского поэта А.С. Пушкина!

Давайте разберем на примере Александра Сергеевича некоторые сложности, на которые можно наткнуться, выясняя по ДНК индивидуальную родословную. По 1/8 своих генов «солнце русской поэзии» получил из Эфиопии и Германии: прабабка поэта, урожденная Христина-Регина фон Шёберх, говорила: «Шорн шорт делат мне шорни репят...» Дед Пушкина, Осип Абрамович, получил половину эфиопских генов, включая Y-хромосому — скорее всего, одной из африканских групп, A или B. (Такую гаплогруппу, переданную по прямой мужской линии, наверняка можно найти у белобрысых жителей Пскова и окрестностей: Ганнибалы долго жили в селе Михайловском Псковской губернии).

У сыновей Сергея Львовича Пушкина и Надежды Осиповны Ганнибал (ее мать, Мария Алексеевна Ганнибал, тоже происходила из рода Пушкиных, но другой его ветви), была четверть эфиопских генов, но мтДНК они получили от матери, вероятно (хотя совсем не обязательно) гаплогруппы H, а Y-хромосомная гаплогруппа у них, скорее всего, была самая что ни на есть славянская, R1a. Как писал сам Александр Сергеевич Пушкин, «Мы ведем свой род от прусского выходца Радши или Рачи... выехавшего в Россию во время княжества св. Александра Ярославича Невского». Пушкин ошибался: Радша «прииде из немцев» столетием раньше и, как установили пушкинисты, не «из немцев», а из Сербии, точнее — из города Петроварадина. В Сербии восточно-славянская гаплогруппа R1a встречается еще чаще, чем в России (хотя типично южнославянской считается I1b). А если бы Радша действительно вышел «из немцев», то в Пруссии R1a — одна из самых распространенных групп: и от общего индоевропейского предка, и от лужичан (сорбов), давным-давно переселившихся от Адриатического моря далеко на север. Вполне возможно, что многие сербы и хорваты по фамилии Раджич — родственники Пушкина.

 

Поскреби русского — найдешь татарина

Коренных народов на свете не бывает. Даже носители самой древней Y-хромосомной гаплогруппы А в современной Африке сейчас чаще всего встречаются далеко от предполагаемого места жительства «хромосомного Адама». Носители ее составляют в племенах бушменов и готтентотов те же 45%, что и среди сильно отличающихся от них по антропологическим данным арабов Судана. На втором месте — эфиопские племена амхара и оромо, которые живут примерно там же, где в отнюдь не райских условиях жил наш прародитель. А кого считать коренными англичанами? Иберийцев, которые переселились в Англию с территории Испании еще в III тысячелетии до н.э.? Кельтские племена, которые примерно с 700 года до н.э. по очереди пересекали Ла-Манш из Бретани и вытесняли предшественников с насиженных мест? Потомков римских легионеров или германских племен англов, саксов, ютов? А к какой национальности приписать норманнов — к будущим французам или бывшим викингам? А ведь по археологическим данным, на Британских островах люди жили и до последнего ледникового периода, а с отступлением ледника совсем другие племена снова заселили эту землю. Так что британцы, как и все нынешние народы, — мигранты и метисы.

 

О чистоте крови

По половым маркерам можно не обнаружить наличия «черных» генов даже у очень чернокожего мулата, если неграми у него были мать отца и отец матери. Чтобы отыскать восьмушку африканской крови (см. про Пушкина) в индивидуальной пробе, а не в достаточно большой выборке — неизвестно, сколько тысяч соматических маркеров нужно перебрать и возможно ли это в принципе.

Со специалистами в области этногеномики разговоры о «чистоте крови» лучше не заводить — можно и на грубость нарваться. Это среди дилетантов встречаются любители померяться длиной и толщиной хромосом с представителями других гаплогрупп, но расистам и националистам делать анализ ДНК опасно: как бы не случился от этого кризис самоидентификации. Представьте себе сочетание неонацистской идеологии, светловолосого и голубоглазого фенотипа, который определяют соматические хромосомы, и типично еврейской гаплогруппы J1 по отцовской линии, а по материнской — то ли азиатской, то ли индейской митохондриальной группы X. Часть ее носительниц, двигаясь вслед за отступающим ледником, в степях к востоку от Аральского моря повернула не на восток, вплоть до Америки, а на Запад, добравшись еще в доисторические времена аж до Оркнейских островов у берегов Шотландии. А ортодоксальный иудей с живописной фамилией Левитан вполне может найти у себя истинно нордическую, выдержанную финно-угорскую гаплогруппу N: евреи-ашкенази долго жили на западе Европы...

Изучение молекулярной генеалогии — лучший способ не только понять, что все люди — братья, но и найти дополнительную информацию для анализа персональной родословной. В базе данных компании Family Tree DNA, той самой, в лабораториях которой делают анализы для проекта «Генография», весной 2007 года было свыше 90 000 результатов тестирования Y-DNA, более 41 000 записей анализа мтДНК и почти 4000 фамильных проектов. И это далеко не единственная такая база, и доступ в большинство из них открытый и бесплатный или очень дешевый. Правда, все исследования связей фамилий и гаплотипов проводятся в странах Западной Европы и Северной Америки, а в России есть только один такой проект — Фамильный клуб Сычевых. Но у нас еще всё впереди.

 

Источник: bio.fizteh.ru

Поделиться в соц. cетях!28.11.2018 14:16